EST details — SGN-C64248

Search information 
Request: 64248Match: SGN-C64248
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64248Clone name: cLEM-5-J13
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180848 is on microarray TOM1: SGN-S1-1-3.3.17.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180848 [TUS-35-G22] Trace: SGN-T193873 EST: SGN-E392547 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271439Length: 585 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271439 [] (trimmed) GGTTGCAGTTTGCTGATTTGCTTGAGAGGCACAGTGATGAACTTGCAGCACTTGAGACTTGGGATAAGGGAAAGCCTTACGAACAAGCTGCAAAT
GAAGAAATACCAATGCTCATTCGTCTTTTCAGATACTATGCTGGTTAAGAAAATAAGAAAAATGGCGTTATGTTTCCTTTTGACAGTTTAATAAC
CACTTATTGTATATCAATTGACGTTCTAATGTTTGCTGAATCACCCTAAATGCTTTTCTAAGTATTTCTGCTTACATTTCTTATTCAGGTTGGGC
TGATAAAATTCATGGTCTTACAGCTCCTGCTGACAGTTTGCACCATGTTCAGACCCTGCATGAGCCAATTGGTGTTGCAGGACAGATAATACCCT
GGAATTTTCCGTTATTAATGTTCGCCTGGAAAGTTGGCCCTGCACTTGCTTGTGGTAACACTGTCGTACTAAAACCAGCAGAACAAACACCACTC
TCTGCCCTGTATGTGTCAAAGTTATTCCATGAGGTTGGACTTCCCCCTGGAGTCTTAAATGTCATTCCTGGATCCGGTAGTGCAGGTGCAGATCT
TGCCAGTCATATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271439] SGN-U584019 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85244 [Download] [View] Facility Assigned ID: TGFAS55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5