Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C64625

Search information 
Request: 64625Match: SGN-C64625
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64625Clone name: cLEM-6-L12
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178147 is on microarray TOM1: SGN-S1-1-8.3.4.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178147 [TUS-28-G9] Trace: SGN-T183226 EST: SGN-E370299 Direction: 3' Facility: INRA
Clone: SGN-C178147 [TUS-28-G9] Trace: SGN-T183227 EST: SGN-E370300 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270936Length: 530 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270936 [] (trimmed) ACGAGGGAACCCACCACCCCAAACCCCCAACCACACCTTCTTAAGCAGAGTGTTGTAACAAAGAGTTGAGTGAAAAAATCATTAGGTGCAAAATG
GCTCTACAAGCAGCATCTTTGCTTCCATCTGCATTTTCTCTACACAAAGAGGGTAAAACATCAAGTGCTAATCTCAAGGACAGTAGCTTCTTTGG
AGTTGCATTGTCTTGCAATCTGAAATCTAAATTTACTCCTGCTGCAGGAAACAAGGAATTGACAAGGAAATTAGCGATTGTACCTATTAGAGCAC
AAACAGCTGCTACCACTCCTGCAATCACCCAGTCTACCTCAGGACAGAAGAAAACACTCAGGAAAGGCAATGTGATAATCACCGGAGCCTCCTCT
GGTTTAGGACTAGCTACAGCAAAGGCTATAGGCGAGTCAGGAGACTGGCACGTTATAATGGCCTGTAGGGACTTCCTCAAGGCTGAAAAAGCAGC
AAAATCACTTGGCATTCCGAAGGAAAATTACACTGTCATGCATCTGGATCTCGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270936] SGN-U578669 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84692 [Download] [View] Facility Assigned ID: TGFAX66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5