EST details — SGN-C64660

Search information 
Request: 64660Match: SGN-C64660
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64660Clone name: cLEM-6-M24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178168 is on microarray TOM1: SGN-S1-1-3.4.4.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178168 [TUS-28-H6] Trace: SGN-T183710 EST: SGN-E370778 Direction: 3' Facility: INRA
Clone: SGN-C178168 [TUS-28-H6] Trace: SGN-T183711 EST: SGN-E370779 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270862Length: 291 bp (412 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270862 [] (trimmed) GGTCTCACTTGCCTTTCAGAGGATAACCGGAGCGGCGACCACCTTGCTTGACAAAATGGCGCAAGAATCACTTGTCCTTCGCGGCACCATGAAAG
CCCACACCGATTGGGTCACTGCCATCGCCACCCCAATTGATAACTCTGACATGATTGTTACTTCCTCCGGGGACAAGTACATCATTGTGTGGTCT
CTCACCAAGGATGGCGCACAGTACGGTGTCCCCCGCCGCCGTCTCACAGGCCACGGCCACTTTGTTCAGGATGTTGTTCTCTCCTCCGACGGTAT
GTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270862] SGN-U582604 Tomato 200607 Build 2 93 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84618 [Download] [View] Facility Assigned ID: TGFAV84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5