EST details — SGN-C64693

Search information 
Request: 64693Match: SGN-C64693
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64693Clone name: cLEM-6-O16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178187 is on microarray TOM1: SGN-S1-1-8.1.4.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270696Length: 294 bp (408 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270696 [] (trimmed) GTGGGTTTCGAAGATTGTATTGTATTCTTTCTGGCAAAGTTCATGTTCTTGGAGAGTTCGCTTCGCCTTAAATCTCAAAGGTCTTTCTTATGAAT
ATAGAGCAGTCAACCTTGGCAAAGGAGAACAGTTCACTTCAGAGTTTGATAAATTAAATCCTCTTCATTATGTTCCTGTTTTGGTAGATGGTGAT
GTGGTAATTTCAGACTCCTATGCAATTTTACTGTATTTGGAAGAGAAGTATCATCAGAGACCCCTGTTGCCAATTAAACCTCAATTAAGAGCTCT
CAATCTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270696] SGN-U600717 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84452 [Download] [View] Facility Assigned ID: TGFAV92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5