EST details — SGN-C64720

Search information 
Request: 64720Match: SGN-C64720
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64720Clone name: cLEM-6-P23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178203 is on microarray TOM1: SGN-S1-1-8.1.4.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178203 [TUS-28-I17] Trace: SGN-T183304 EST: SGN-E370377 Direction: 3' Facility: INRA
Clone: SGN-C178203 [TUS-28-I17] Trace: SGN-T183305 EST: SGN-E370378 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270911Length: 444 bp (942 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270911 [] (trimmed) GGCTTTGTACTGCGATGGCGGCGGCGGCGGCGTGTTCTTCATACACCGGTGAAGTGACGGAGAGAAGAGGTATACCGGCGGCATCATTCGTACAA
GACGTTCAGTCTTATCTCAGCCAATCTGGTCTCGATGTTAACTCTGCTCTTGCATTCCTACAAGAAAGACTTCAGCAGTACCGAGTGGTTGAAAT
GAAACTTCTGGCCCAGCAGAGGGATCTTCAAGCAAAGATTCCTGACATAGAGAAATGCTTGGATATAGTTGCTACTTTGCAAGCTAAGAAAGACA
GCAATGAGGCACTAGTCGCTGATTTTGAAGTGTCAGAAAGTATTTATTCCCGGGCTAAGATTGAAGATGCTGAATCTGTGTGTTTATGGCTAGGG
GCAAATGTCATGCTACAGTATTCATGCGAAAAGGCTACTGCCCTTCTTCAAACAAACTTGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270911] SGN-U570517 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84667 [Download] [View] Facility Assigned ID: TGFAW96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5