EST details — SGN-C65057

Search information 
Request: 65057Match: SGN-C65057
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65057Clone name: cLEM-8-D15
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178248 is on microarray TOM1: SGN-S1-1-3.3.4.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178248 [TUS-28-K14] Trace: SGN-T183441 EST: SGN-E370251 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271845Length: 467 bp (974 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271845 [] (trimmed) GCTATCAAGACTAATGTAGTTGGTACTTTGAACATGCTGGGATTGGCTAAAAGAGTCGGTGCGAGGTTTTTGCTAACCAGCACTAGCGAAGTATA
TGGTGATCCTTTAGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAATCCTATTGGTGTCCGAAGTTGCTACGATGAGGGAAAACGAACAG
CTGAAACATTGACAATGGATTATCACAGAGGTGCAGAAGTTGAGGTGAGAATCGCTAGGATCTTTAACACTTATGGACCTCGTATGTGTATTGAT
GACGGTCGCGTTGTCAGCAACTTTGTCGCTCAGGCTTTAAGGAAAGAGCCTTTGACAGTTTATGGTGATGGGAAACAAACAAGAAGTTTCCAATT
TGTTTCAGATCTGGTTGAAGGCTTAATGCGGTTGATGGAAGGAGAACATGTCGGACCCTTCAACCTCGGAAACCCTGGTGAATTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271845] SGN-U582988 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85396 [Download] [View] Facility Assigned ID: TGFBE20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5