Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C65061

Search information 
Request: 65061Match: SGN-C65061
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65061Clone name: cLEM-8-D2
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178250 is on microarray TOM1: SGN-S1-1-1.3.4.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178250 [TUS-28-K16] Trace: SGN-T183378 EST: SGN-E370188 Direction: 3' Facility: INRA
Clone: SGN-C178250 [TUS-28-K16] Trace: SGN-T183379 EST: SGN-E370189 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271879Length: 574 bp (975 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271879 [] (trimmed) GAAGAGTTGAGAGAGATCTCATCGGCTTTATACTTTTTGAAGAGATCTCATCCTTTTTTCCTTTCAGTTTCAGATCTCTATATCTTTTTCCAGAA
TTTTGAATCAGGTTTCGCTTATTGGGTAGATTCAGCCATGGATTTCATGAAGGTCTTCGATCAAACGGTTCGCGAAATAAAGAGGGAGGTGAATT
TGAAAGTATTGAAAGTCCCTGAGATCGAGCAGAAGGTATTGGATGCTACTGATGATGAGCCCTGGGGCCCTCATGGTACTGCTTTGGCTGAGATA
GCACAGGCTACAAAAAAATTCTCCGAGTGTCAGATGGTCATGAATGTGCTCTGGACAAGATTGACTGAAACTGGAAAGAACTGGCGATATGTCTA
TAAGTCATTGGCTGTTATAGAGTACTTGGTGGCGCATGGAGCTGAACGTGCAATTGATGACATCATAGAACATACCTATCAGATCTCTTCTCTCA
CAACTTTCGAGTATGTTGAGCCAAATGGTAAGGATGTGGGAATTAATGTGAGGAAGAAAGCGGAAAATGTTGTGGCATTATTAAATAACAAAGAG
AAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271879] SGN-U563475 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85430 [Download] [View] Facility Assigned ID: TGFBF13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5