Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C65086

Search information 
Request: 65086Match: SGN-C65086
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65086Clone name: cLEM-8-E24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178266 is on microarray TOM1: SGN-S1-1-1.4.4.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178266 [TUS-28-L8] Trace: SGN-T183661 EST: SGN-E370729 Direction: 3' Facility: INRA
Clone: SGN-C178266 [TUS-28-L8] Trace: SGN-T183662 EST: SGN-E370730 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271972Length: 550 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271972 [] (trimmed) GTAGATGTCAAAAGCAGGGGAGAAATGAGTTTGTGATACGTCTGCAACCTTCAGAAGCCATGTACATGAAGCTTACGGTCAAGAAACCTGGGCTT
GAAATGTCAACTGTTCAAAGTGAATTAGACCTGTCGTATGGGCAGCGTTACCAAAGAGTTGTCATTCCAGAGGCTTATGAACGTCTGATTCTCGA
CACAATAAGAGGAGATCAGCAGCATTTTGTGCGTAGGGATGAGCTCAAGGCGGCTTGGGAGATTTTTACCCCTCTTTTGCATAGAATTGACAATG
GAGAGGTGAAGCCAATTCCATACAAGCCAGGCAGCAGAGGCCCTGCTGAAGCAGATGAGTTGTTGCAACATGCCGGTTACGTTCAAACTCATGGC
TATATATGGATCCCTCCCACACTATAAGTTTGGAAAAGTATTGCAGATGAGTGCTACCTCGTCACTTTTGCCATGTAGTATCCTGCTTATGTGCA
AACTTATTGAGAAGTAACAAACAGTCCGTGTACCACAAATATATTTGCATGTAATAATCTCATCTTTTTTAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271972] SGN-U571535 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85523 [Download] [View] Facility Assigned ID: TGFBD36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0051 Quality Trim Threshold: 12.5