EST details — SGN-C65093

Search information 
Request: 65093Match: SGN-C65093
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65093Clone name: cLEM-8-E9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178270 is on microarray TOM1: SGN-S1-1-5.4.4.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178270 [TUS-28-L12] Trace: SGN-T183663 EST: SGN-E370731 Direction: 3' Facility: INRA
Clone: SGN-C178270 [TUS-28-L12] Trace: SGN-T183664 EST: SGN-E370732 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271764Length: 605 bp (838 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271764 [] (trimmed) GGATCATCATCAACGAGAGCGTGATGGGGCTCACATTCACCAAGCTCTTCAGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGT
CTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTTGAAGCTGGGAGAGATCGTGACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGT
TGAGTACAAGAACATCAGCTTCACTGTTTGGGATGTCGGAGGTCAGGACAAGATCCGTCCATTGTGGAGGCACTACTTCCAGAACACTCAGGGTC
TCATTTTTGTGGTTGATAGCAATGATAGAGACCGTGTTGTAGAAGCAAGAGATGAATTGCATAGGATGTTGAACGAGGATGAACTTCGGGATGCT
GTGCTTCTAGTATTTGCTAACAAACAAGATCTTCCTAACGCAATGAATGCTGCTGAAATAACTGATAAGCTTGGACTGCACTCCCTCAGGCAGCG
TCACTGGTACATCCAGAGCACTTGTGCAACTTCTGGCGAGGGGCTTTATGAGGGACTTGATTGGCTTTCTAACAACATTGCTAACAAGGCTTAAA
GTGATGCAGATTTGTTATTGTGGGTTGATCCTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271764] SGN-U580248 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85315 [Download] [View] Facility Assigned ID: TGFBC29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0015 Quality Trim Threshold: 20.5