Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C65120

Search information 
Request: 65120Match: SGN-C65120
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65120Clone name: cLEM-8-G15
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178282 is on microarray TOM1: SGN-S1-1-1.4.4.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271935Length: 685 bp (836 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271935 [] (trimmed) TTTCCATGGTTCCAATGGTGAGAAGATTGTCGCAGAAGATATTCCTGCTGATATGGAAGCAATTGCTTCTGAGAAGCGGCGAGAGCTAATTGAAG
CAGTCTCTGAGGTTGATGATAAGCTTGCCGAATCATTTCTGAATGATGAGCCTATATCATCTGCTGATCTTGAGGCAGCCATAAGGAGAGCGACA
ATAGCACGGAAGTTTGTTCCTTTTTTTATGGGTAGTGCTTTCAAGAACAAGGGAGTTCAAACACTTCTTGATGGCGTTCTCAGTTACTTGCCTTG
TCCAGTTGAAGTTAGCAACTATGCTCTGGATCAAACAAAGGATGAAGAGAAGGTTACCTTAACCGGAAACCCTTCTGGCCCTTTGGTTGCCCTGG
CATTTAAATTAGAGGAAGGCCGTTTTGGTCAATTGACCTATTTAAGAATCTATGAAGGTGTCATCCGGAAGGGCGATTTTATAATCAACGTGAAC
ACGGGAAAGAAGATTAAGATTCCTCGCTTGGTGAGAATGCATTCAAATGAGATGGAGGATATCCAAGAGGCTCATGCTGGGCAGATAGTTGCTGT
GTTTGGCGTAGATTGTGCATCAGGGGATACTTTTACTGATGGATCAGTCAAATACACTATGACTTCTATGAATGTACCTGAACCAGTGATGTCAT
TAGCTGTTTCACCTGTTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271935] SGN-U570886 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85486 [Download] [View] Facility Assigned ID: TGFBC44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5