EST details — SGN-C65169

Search information 
Request: 65169Match: SGN-C65169
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65169Clone name: cLEM-8-I19
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178312 is on microarray TOM1: SGN-S1-1-3.2.4.4
See unigene SGN-U580349 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C178312 [TUS-28-N6] Trace: SGN-T183671 EST: SGN-E370739 Direction: 3' Facility: INRA
Clone: SGN-C178312 [TUS-28-N6] Trace: SGN-T183672 EST: SGN-E370740 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271941Length: 656 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271941 [] (trimmed) GCTAGAAGAGCCCTTCACCGTTGCAGTGCAAACCCACCGGAACCCTAGGATACTTCGTCGCCGGCAACCATGGGTATCTCTCGGGATTCGATGCA
CAAGAGACGTGCCACTGGAGGCAAGAAGAAGGCATGGAGGAAGAAGCGAAAGTATGAGATGGGAAGACAGTCTGCAAATACAAAGTTGGTGCCTA
ATGCTAAGACTGTTAGGAGGATCAGGGTCCGAGGAGGCAATGTGAAGTGGCGTGCTTTGAGGTTGGACACTGGAAATTACTCTTGGGGTAGTGAA
GCTGTTACTAGGAAGACCCGTTTATTGGATGTTGTCTACAATGCCTCAAACAACGAGTTGGTTAGAACACAAACTCTAGTGAAGAGTGCTATTGT
GCAAGTTGATGCAGCTCCATTTAAACAGTGGTATCTCCAGCACTATGGTGTTGAAATTGGTCGCAAGAAGAAGAGTGCTGCCAAGAAGGAAGGAG
AGGAGGTTGCTGAGGCTGCTGCAGAGGAGAAGAAAAGTAACCATGTCCAAAGAAAGCTGGAAAAACGTCAACAGGATCGTAAGATTGACGCACAT
ATTGAAGAGCAATTTGCTAGTGGTCGTCTTTTGGCGGCAATCTCATCACGACCTGNCCAATGTGGTCGTGCTGATGGTTACATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271941] SGN-U580349 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85492 [Download] [View] Facility Assigned ID: TGFBC58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5