Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C65315

Search information 
Request: 65315Match: SGN-C65315
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65315Clone name: cLEM-8-P14
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178406 is on microarray TOM1: SGN-S1-1-5.2.4.13
See unigene SGN-U577411 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C178406 [TUS-29-B4] Trace: SGN-T184171 EST: SGN-E371404 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272085Length: 392 bp (993 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E272085 [] (trimmed) GATTCTATTAAACAGCGGAACCCTAAAAACCCTTTTCTGCCACCATTACCGCCGCATCGCCGCCACCATGAACGACGACGGGTTTTCAGCAGAGA
AGTTGTTCAATCAAGGCTACTCCTATACCTACGACGATGTCATCTTCCTCCCTGGTTTCATCGACTTCCCTACCGATGCCGTCAACCTCTCTACT
AAGCTCAGCCGCAATATTTCCCTTTCCATCCCATGCGTAGCTTCTCCGATGGACACCGTCACTGAGACCTCCATGACCGTAAGAATGGCGGCGCT
AGGTGGTATAAGTATCGTTCACTACAACAACACCATTTCGCAACAAGCTTCTATTATCCGCGCTGCTAAGTCTCATCAAATCCCTTTCTCATCGG
ATTTGATATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272085] SGN-U577411 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85636 [Download] [View] Facility Assigned ID: TGFBF91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5