EST details — SGN-C6544

Search information 
Request: 6544Match: SGN-C6544
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6544Clone name: cLEC-35-M13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173999 is on microarray TOM1: SGN-S1-1-4.2.17.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173999 [TUS-17-J13] Trace: SGN-T189153 EST: SGN-E376539 Direction: 3' Facility: INRA
Clone: SGN-C173999 [TUS-17-J13] Trace: SGN-T189154 EST: SGN-E376540 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210438Length: 483 bp (1909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210438 [] (trimmed) CCGTCACCACCGCCGTCCACGGTGGTGAAAAAGGGGCTTACTCATCGCCGCCGCAGCAGCAGAATAAAGTTCAGATTTTTAATATGGGTCAGGGG
TTCAGTTGTGGAACAAGTGATGAACACGGATTGTTTACTGCTGTTCAGTGTGGTGATTTGGAGACTGTAAAGGCTCTGTTTGAGAGAAACCCAAG
TCTTGTTCATCATTCTACAGTTTATGATCGACAGTCTGCTTTACATATTGCTGCTGCCAATGGCCAAATTGAGGTTGTTTCTATGCTTTTAGACA
TGTCTGTTAAGCCTGATTTATTGAATCGGTATAAGCAGACTCCATTGATGCTAGCAGCAATGCACGGGAAGATCTCTTGTGTGCAAAAGCTTATT
GAAGCCGGGGCCAATATTTTGATGTTTGATTCATTGAATGGGAGGACATGCTTGCACTATGCGGCCTATTATGGGTACTCTGATTGTCTCAAAAC
AATTNTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210438] SGN-U578345 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30786 [Download] [View] Facility Assigned ID: TCAFG79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5