EST details — SGN-C6557

Search information 
Request: 6557Match: SGN-C6557
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6557Clone name: cLEC-35-M3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174005 is on microarray TOM1: SGN-S1-1-6.2.17.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174005 [TUS-17-J19] Trace: SGN-T1300 EST: SGN-E378156 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174005 [TUS-17-J19] Trace: SGN-T189157 EST: SGN-E376543 Direction: 3' Facility: INRA
Clone: SGN-C174005 [TUS-17-J19] Trace: SGN-T189158 EST: SGN-E376544 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210279Length: 305 bp (2077 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210279 [] (trimmed) AGTTTAGTTACCCCTCATCTCATTTCCCTTTCCTTCTTCTTTCGATTTATTGCTGCAAAAGCGTTTGTATTGCAGAGTTAGGGTTTCACATATAA
CTGTGTGTGTACTCGCCGATTTTGGTTAGTTAGCAGAGCGAACACACCTCAAGTACAAAAAGGGTATCTGGAGTGCATACGACACGATTACTGGA
AATAAATGGAAGCTCTACTTGTAAGAAAACTGGGCGACCCAACTCTGCCACCAAATGCCTCAGAGAAGTCGTCACTCGATCTCTCAACATCCCAC
CCTATACCTAATTTGGAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210279] SGN-U577157 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30627 [Download] [View] Facility Assigned ID: TCAFG74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5