Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C66086

Search information 
Request: 66086Match: SGN-C66086
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C66086Clone name: cLEN-12-L1
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180901 is on microarray TOM1: SGN-S1-1-6.2.17.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180901 [TUS-35-J3] Trace: SGN-T197712 EST: SGN-E396386 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276100Length: 540 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E276100 [] (trimmed) GAGAAAATGCCATCAACAAGATTACTGAATGTCAAGATCAAAGCACTGCCCTGCTTTGAGCAAGAGGGAATGATATGGATTTGGCCAGGAAATGA
TCCACCTGCAGCTACCCTTCCTTCTTTACTACCACCTTCTGGATTTCAGATCCATGCTGAGATAGTCATGGAACTTCCAGTGGAACATGGACTAC
TTTTAGACAATCTTTTAGATCTTGCACACGCACCTTTCACACATACATCAACTTTTGCTAAAGGATGGAGTGTACCAAGCTTGGTAAAGTTCTTG
ACTCCTGCATCTGGTCTGCAAGGATATTGAGATCCATATCCAATAGATATGGAATTTAGACCACCTTGTATGGTTTTATCCACCATTGGCATCTC
AAAGCCAGGCAAATTGGAAGGACAGAGTACCAAGCAGTGTTCTACGCACCTTCATCAACTGCATGTTTGCTTACCTGCATCACGACAGANAACAC
GGTTATTATATAGAATGTCACTGGATTTTGCTCCCCTGCTGAAACACATCCCCTTCATGCAATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276100] SGN-U580788 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89924 [Download] [View] Facility Assigned ID: TRRBU61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5