EST details — SGN-C66368

Search information 
Request: 66368Match: SGN-C66368
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C66368Clone name: cLEN-13-P22
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180951 is on microarray TOM1: SGN-S1-1-4.4.17.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180951 [TUS-35-L5] Trace: SGN-T196409 EST: SGN-E395083 Direction: 5' Facility: INRA
Clone: SGN-C180951 [TUS-35-L5] Trace: SGN-T199902 EST: SGN-E398576 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274872Length: 537 bp (972 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E274872 [] (trimmed) ATATCAAAGACGTTGAGAATTGTCAAGAGTTCATAAAAGAAGGAGAAAGTTATGAGTTGTGTCTTACAACTCAGATGAGAATGAAGTTGGGGGGA
ATAGATTCTCTGGAACTTTATCGTAATCTCAGAATAAGAAATCCTGCACCATATGCTGCCTGGCTTAATTTTTCAAGGGAAAACCTAAGCATATG
TTGTTCATCACCTGAAAGGTTCCTACGATTGGACAGGAATGCTATTCTAGAAGCAAAACCCATAAAAGGGACTATAGCTCGTGGTTCCACCCCAA
AGGAAGATGAATTTCTGAAACTGCAATTAGAATGCAGTGAAAAGGATCAGGCGGAAAATTTGATGATTGTTGACTTGTTGAGGAATGACCTTGGG
CGTGTATGTGAGACTGGCTCTGTTCATGTCCCACATCTCATGGAAATTGAATCCTATGCAACAGTTCATACCATGGTCAGTACGATTCGGGGGAA
AAAGCGATCAGATGCAAGTGCAATTGATTGTGTTAGAGCTGCATTCCCTGGTGGGTCAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274872] SGN-U583385 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90175 [Download] [View] Facility Assigned ID: TRRBZ95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5