EST details — SGN-C67559

Search information 
Request: 67559Match: SGN-C67559
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C67559Clone name: cLEN-19-I10
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C182431 is on microarray TOM1: SGN-S1-1-4.1.7.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274454Length: 542 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E274454 [] (trimmed) CTTCTTCTTAAATATTTTATTTTCCTTCAAACTATATAGTAATTTCACTTTCCATTTGAAGAGAAGAAAAATGGCAAAGAGTGGTTACAATGCTA
GCTTCTTGTTACTTATCTCAATGTTCTTGATTATGCTCACTTTCTCTAACGTGGTCGAGGGTTACAACAAGCTCCGCCCAACAGATTGCAAGCCA
AGATGTACTTATAGATGCTCAGCAACATCACACAAGAAGCCATGTATGTTCTTTTGTCAAAAATGTTGTGCAACATGTTTATGTGTTCCTAAAGG
AGTTTATGGCAACAAACAATCATGCCCTTGTTACAACAATTGGAAGACTCAAGAAGGAAAACCTAAATGCCCTTAATTAATTAAAATATTAATAA
TTAGGGAAATTAATCTTTTTTTCCCAATAATTAATGGAAAAGATTAAGAATACTATAGCTATATGGTCATATTTGTGTTTTGCATTGCATTAAAT
TGATTTGGAGTAATTATGACTGTAATGCCTTAAGCATTTTGAATTTCTCTACATGTGTTATCATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274454] SGN-U577721 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91390 [Download] [View] Facility Assigned ID: TRRCV53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5