EST details — SGN-C6807

Search information 
Request: 6807Match: SGN-C6807
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6807Clone name: cLEC-36-N18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183830 is on microarray TOM1: SGN-S1-1-5.4.19.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183830 [TUS-43-D4] Trace: SGN-T198090 EST: SGN-E396764 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207432Length: 562 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207432 [] (trimmed) GTTGAACAAAGTACGGCATACCAGCCATGGATTTGGTCTGCTGGGAATCATGAGATAGAGTACTTTCCATATATGGGGGAAGTAGTTCCATTCAG
ATCATTTCTATCTAGATACCCCACACCTTATCGAGCTTCAAAAAGCAGTAATCCCCTTTGGTATGCCATCAGGAGGGCATCTGCTCACATAATTG
TCCTATCAAGCTATTCCCCTTTTGTAAAATATACACCTCAATGGCATTGGTTGAAACAGGAATTTAAAAAGGTGAACAGAGAGAAAACTCCTTGG
CTTATAGTCCTTATGCATGTTCCTATCTACAACAGTAATGAAGCTCATTTCATGGAAGGGGAAAGCATGAGATCCTCCTATGAAAGATGGTTTGT
CAAATACAAAGTCGATGTGATCTTTGCTGGCCACGTCCATGCTTATGAAAGATCATATCGTATATCTAATATACACTACAATGTCTCGGGTGGTG
ATGCTTATCCCGTACCTGATAAAAAAGCTCCTATTTACATAACTGTTGGTGATGGAGGAAATTCAAAAAGTCTTGCTTCAAAATTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207432] SGN-U572371 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31020 [Download] [View] Facility Assigned ID: TCAFN81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5