EST details — SGN-C68369

Search information 
Request: 68369Match: SGN-C68369
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C68369Clone name: cLEN-4-M15
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181024 is on microarray TOM1: SGN-S1-1-3.3.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181024 [TUS-35-O6] Trace: SGN-T193658 EST: SGN-E392332 Direction: 3' Facility: INRA
Clone: SGN-C181024 [TUS-35-O6] Trace: SGN-T199196 EST: SGN-E397870 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272114Length: 640 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272114 [] (trimmed) AAAAGATGGCAGTCTACAGCAAAAAAGATGATTTTCAGGCCACAATTCATAATAGTTATGACAAAATGAGTGACCTAATAGCCTTTGATGATACT
AAGGCTGGTGTCAAAGGGCTTGTTGATTCCGGAATCAATAAAGTACCTCAAGTATTCATTCTACCGCCAAAATACAGGGTAAAAACATGTGAAAC
ACACATCAGTTTTCCAGTGATAGACCTCAAAGGCATTGATGAGGATCCGATAAAGTATAAGGAGATTGTGGACAAAGTTCGAGATGCATCGGAGA
CATGGGGTTTCTTTCAAGTGGTTAATCATGGAATTCCAACATCCATCTTGGAAAAAACGTTACTAGGAACACGACAGTTTTTCGAGCAAGATACC
GAGATCAAGAAACAATATTACACTCGAGATATTGGGGAAAAGGTGATTTATACTAGCAATCTTGATTTGTATAGCCCTTCTGTTCCAGCTGCAAG
TTGGAGAGACTCAATTTTCTTTTTCATGGCTCCGAATCCTCCTAGTCCACAAGAATTTCCAACAGCTTGCGGGGAAATTCTAATGGACTACTCCA
AGTATGTGACGGAATTGGGGTTCTCCTTGCTTGAATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272114] SGN-U579001 Tomato 200607 Build 2 109 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88131 [Download] [View] Facility Assigned ID: TRRAM80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5