Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C6849

Search information 
Request: 6849Match: SGN-C6849
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6849Clone name: cLEC-37-A20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174041 is on microarray TOM1: SGN-S1-1-2.4.18.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174041 [TUS-17-L7] Trace: SGN-T189161 EST: SGN-E376547 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208346Length: 431 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208346 [] (trimmed) CTCAAATTTCAACGCTTTCTTTTACGTCTCTTTAATTATCCCACGAAGATTCAGATTCCGGTCAATTCTCGCCGGCAAATCCCTCCGTCACCGGC
GAATTTCATCGGCCGTCGATCTCAATGAATCCTGAATATGACTACCTGTTTAAGCTTTTGCTCATTGGTGATTCTGGTGTTGGGAAATCATGTCT
TCTTCTGAGGGTTGCTGACGACACATATCTGGAGAGTTACATAAGCACCATTGGAGTGGATTCTAAAATCCGTACCGTAGAACAAGATGGGAAGA
CTATAAAACTTCAGATTTGGGATACAGCTGGACAAGAACGCTTCAGGACCATCACTAGCAGCTACTATCGTGGAGCCCATGGCATAATTGTTGTG
TATGATGTGACAGATCAAGAGAGCTTCAATAATGTACAACAGTGGTTGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208346] SGN-U581297 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31337 [Download] [View] Facility Assigned ID: TCAFP10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5