Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C6910

Search information 
Request: 6910Match: SGN-C6910
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6910Clone name: cLEC-37-D5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174065 is on microarray TOM1: SGN-S1-1-2.1.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174065 [TUS-17-M7] Trace: SGN-T191452 EST: SGN-E390126 Direction: 5' Facility: INRA
Clone: SGN-C174065 [TUS-17-M7] Trace: SGN-T197502 EST: SGN-E396176 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208395Length: 564 bp (759 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208395 [] (trimmed) CTTTAAAAAACTTCTAAAGTTAGAAAATACTATGGCTTCTAAGAGAACTACTTCCCTTGCTCTTTTTGTCCTTGTGAACCTTCTTTTTTTCACTC
TTGTGAGTGCATGTGGCACTTGTCCAGGTCCTAAACCAAAGCCGAAGCCAAAGCCAAAGCCAAAGCCAACCCCGAGCCCTAGCTCAAAAGGCAAA
TGCCCTATTGATACACTAAAATTAGGTGTTTGTGCTAATGTTCTTGGAAATTTGCTTGGAGTAGTACTTGGAAATCCACCAAAGAAACCTTGTTG
CTCTCTAATTGAAGGACTTGTTGATCTAGAGGCTGCTCTTTGTCTTTGCACTGCCATTAAAGCAAATATTCTTGGGATTAACCTAAATGTCCCTC
TTTCTCTAAGCCTTCTTCTTAATGTTTGTGGCAAAAAAGCTCCATCTGGCTTTCAATGCCCTAAGTGAACAAACAAACAATAGCTACTACGTCTC
AGTCCCAAATAAGTTGGGGTCAGCTATATGAATGTTCATTCTATCACTACTATATAGTTTGATTTGAGNTTTTTGGATTTTTAATTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208395] SGN-U580324 Tomato 200607 Build 2 154 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31386 [Download] [View] Facility Assigned ID: TCAFQ15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5