Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C69266

Search information 
Request: 69266Match: SGN-C69266
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69266Clone name: cLEN-9-J15
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180769 is on microarray TOM1: SGN-S1-1-2.4.17.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180769 [TUS-35-D15] Trace: SGN-T196374 EST: SGN-E395048 Direction: 3' Facility: INRA
Clone: SGN-C180769 [TUS-35-D15] Trace: SGN-T196375 EST: SGN-E395049 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275141Length: 582 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275141 [] (trimmed) CAATGGCGGAAGTTACTAAAATTCTCCAACCAGTTCTTCTTCCTCCTTTCTTCCATAAACTAGACGGAACCACTAATTCCCATTTTAGATTGTGT
AGAAGAAACAGACGCAACATCAGTATCCGTTGTTCTTCAATTTCTACAACTGAAACTAACAAATCCACAAAGACTCAGAACATTCCATGGGGTTG
CGAGACTGATTCTATAGAAAATGCGTCCAATTTGCAGAAATGGTTGACGGAATCAGGGCTTCCTGCTCAAAAATTGGACTTACAAAGAGTGAATG
TTGGAGAAAGAGGACTTGTTGCTAACAACAATATTAGGAAAGGGGAAAGGCTGCTTTTTGTTCCTCCTTCACTTGTCATCACTGCTGATTCGAAA
TGGAGCAATTCAGATGCTGGTGATGTTTTAAAACAATATAATGTACCAGATTGGCCTTTTATTGCTACATATTTAATAAGTGAGGCAAGCCTCAT
GAAGTCTTCAAGATGGAGCAACTACATATCTGCCTTGCCTAGGCAGCCTTACTCTCTCTTATACTGGACTCAATCGGAGTTAGATAGGTACTTGG
AAGCATCACAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275141] SGN-U563777 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89013 [Download] [View] Facility Assigned ID: TRRBI56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5