EST details — SGN-C6961

Search information 
Request: 6961Match: SGN-C6961
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6961Clone name: cLEC-37-G13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174089 is on microarray TOM1: SGN-S1-1-2.2.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174089 [TUS-17-N7] Trace: SGN-T189101 EST: SGN-E376487 Direction: 3' Facility: INRA
Clone: SGN-C174089 [TUS-17-N7] Trace: SGN-T189102 EST: SGN-E376488 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208324Length: 394 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208324 [] (trimmed) GTGTGTGTGAGAAGTTGCCAAGATCTGTGATTTTTCTGAGTAGATCTGTTGGTGGGGTTTGTTGAAAAAGATTCAATTTTGATCTTGTTTAGAGA
AAAGATGAATATATTCAGGCTTGCTGGGGATATGACCCATTTGGCTAGTGTTCTTGTTTTGCTTCTCAAGATCCATACTATTAAATCTTGTGCTG
GTGTTTCTCTGAAGACGCAAGAGCTATATGCTCTTGTCTTTGTTACTCGCTACTTGGACATATTTACAGACTTTATTTCACTATACAATACTACA
ATGAAGTTGGTTTTCTTGGGAAGCTCTTTGTCAATTGTGTGGTACATGAGGCATCACAAAATTGTTCGGAGATCTTATGACAAAGACCAAGATAC
TTTCCGTCATGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208324] SGN-U575360 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31315 [Download] [View] Facility Assigned ID: TCAFO43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5