EST details — SGN-C69618

Search information 
Request: 69618Match: SGN-C69618
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69618Clone name: cLER-12-B16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185349 is on microarray TOM1: SGN-S1-1-6.3.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185349 [TUS-47-C11] Trace: SGN-T192055 EST: SGN-E390729 Direction: 5' Facility: INRA
Clone: SGN-C185349 [TUS-47-C11] Trace: SGN-T192298 EST: SGN-E390972 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283464Length: 556 bp (987 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283464 [] (trimmed) CAGATCGAGCAAAAATCAAAGGGGATGGCGCCGCCGAACACAGGATTAGCAGTGGGATTGAACAAAGGACACATTGTAACCAAGAAGGAGTTAGC
TCCACGCCCTTCTGACAGAAAAGGGAAAACCAGCAAAAGAATCCACTTCGTCAGGAGCCTCATCAGAGAAGTTGCTGGATTTGCTCCATATGAGA
AGAGGATTACTGAGCTTCTTAAAGTTGGTAAGGACAAGCGTGCATTGAAGGTAGCCAAGAGGAAGTTGGGTACCCACAAGAGGGCAAAGAAGAAG
AGAGAGGAGATGTCCAGCGTTCTCCGTAAGATGAGGGCAACCGGTGGTGGTGAAAAGAAGAAGTGAAGTCTCTATCCTTATTTTGACAATTGAGG
AACTGAGTTTATTAGTTAATACATGATCTTTTTGAGTTAGCTATAAAATTCTCTAAACTTTGACACAATTATGGCTTTGAATTTTCATTGAGATT
GTGACATTTTGCTCAAACAAGTCTACATTTTAGTTATGTTCTGTATTTTACATTTTTGTTAAATTGTTGATCCTTGTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283464] SGN-U580851 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94431 [Download] [View] Facility Assigned ID: TPRBV08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5