EST details — SGN-C6971

Search information 
Request: 6971Match: SGN-C6971
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6971Clone name: cLEC-37-G23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181948 is on microarray TOM1: SGN-S1-1-7.1.10.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181948 [TUS-38-E18] Trace: SGN-T194579 EST: SGN-E393253 Direction: 5' Facility: INRA
Clone: SGN-C181948 [TUS-38-E18] Trace: SGN-T194793 EST: SGN-E393467 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208170Length: 483 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208170 [] (trimmed) AATAGACTTCTATATATTGTGAAGTACAAAAAGTACATTAGGAAATAAAATAGGAATTACTTATTTCAAGCTACAAAGGAAACAAGAAGTTACCA
CACACTTGAACATTGCTCATAAGCAAAACAAAATTAAAAATCCAAAAAACTCAAATCAAACTATATAGTAGTGATAGAATGAACATTCATATAGC
TGACCCCAACTTATTTGGGACTGAGACGTAGTAGCTATTGTTTGTTTGTTCACTTAGGGCATTGAAAGCCAGATGGAGCTTTTTTGCCACAAACA
TTAAGAAGAAGGCTTAGAGAAAGAGGGACATTTAGGTTAATCCCAAGAATATTTGCTTTAATGGCAGTGCAAAGACAAAGAGCAGCCTCTAGATC
AACAAGTCCTTCAATTAGAGAGCAACAAGGTTTCTTTGGTGGATTTCCAAGTACTACTCCAAGCAAATTTCCAAGAACATTAGCACAAACACCTA
ATTTTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208170] SGN-U580324 Tomato 200607 Build 2 154 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31161 [Download] [View] Facility Assigned ID: TCAFO48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0129 Quality Trim Threshold: 12.5