Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C69754

Search information 
Request: 69754Match: SGN-C69754
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69754Clone name: cLER-12-H6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185353 is on microarray TOM1: SGN-S1-1-2.3.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185353 [TUS-47-C15] Trace: SGN-T192057 EST: SGN-E390731 Direction: 3' Facility: INRA
Clone: SGN-C185353 [TUS-47-C15] Trace: SGN-T192058 EST: SGN-E390732 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283323Length: 620 bp (964 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283323 [] (trimmed) TTGGAGTTTGACAATTTTCCAGCCATAGTTAAATTTTACACCAACAATAAATATAGCTTCTCATCACGCTAAATAGATGCTCGATGCATACAATT
TATAAGTACTAAAGACCTCATCAGTTTGAGAACAAATGAACAGATTCCATCTTTTCCAGACGGGAAAAAATAGTTGTACGAAAGCATAAAAGAGG
ACAATTTCTGTTTCAACTTCTGGTACATATGCAAATGATATAAACTACTTGATATATTGCGAAACCCACTTAAAGCCATCACCATAACCCATTTT
GCGTACAATACTGCACATAAACACCTCCAAGGGACGAACACTAGAATCAGCTAGATTCACCTTACCCTTGCCAGTAGTGACACCAGTCAACCCAA
GGTGATAACGCAACTCATCTTCTGAGGCAGCATACGGTATGTCTATCTTGTTTCCCAAAATGAGGAAGGGAACAGTCGCTAGGGACTCATCAGAT
AGCAGTGCGTCTAATTCTTTCTTTGACTCAGCGAAGCGCTCTTTGTCATAAGCATCTACCAGGTATACAACAGCATCAACCTTAGCATAGTAATC
CTTCCAAACACGGCGAGCGATCTGATGACCTCCTAAATCAAACGCTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283323] SGN-U579915 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94290 [Download] [View] Facility Assigned ID: TPRBV39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5