EST details — SGN-C69853

Search information 
Request: 69853Match: SGN-C69853
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69853Clone name: cLER-12-M6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185995 is on microarray TOM1: SGN-S1-1-8.2.7.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185995 [TUS-48-N9] Trace: SGN-T1920 EST: SGN-E378656 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185995 [TUS-48-N9] Trace: SGN-T192568 EST: SGN-E391242 Direction: 5' Facility: INRA
Clone: SGN-C185995 [TUS-48-N9] Trace: SGN-T192810 EST: SGN-E391484 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283407Length: 417 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283407 [] (trimmed) TAAAAAAAAAAAAAACATTTTATAGCTAAGTAAGTAAACGCAATGGCTTCCTCAATTGTCTCATCGGCAGCCGCTGCTACCCGTAGCAATGTTGC
TCAAGCTAGCATGGTCGCACCCTTCACCGGACTCAAATCCGCCGCTTCTTTTCCCGTTACCAAGAAGAACAACAACGTTGACATTACCTCCCTTG
CTAGCAATGGTGGACGCGTTAGATGCATGCAGGTTATTCAAAAATAAGTGATTCAATTATCAGTATGTATATATAATTTAAATTCAACGCGATTA
TTTTATAATCGTGGAATGTTTGACTAATGTAGGTGTGGCCACCAATCAACATGAAGAAATACGAGACATTGTCATACCTTCCTGACTTGTCCGAT
GAGCAATTGCTTAGCGAAAATGAGTATCTTTTGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283407] SGN-U577820 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94374 [Download] [View] Facility Assigned ID: TPRBT75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0140 Quality Trim Threshold: 14.5