EST details — SGN-C7021

Search information 
Request: 7021Match: SGN-C7021
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C7021Clone name: cLEC-37-I8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174111 is on microarray TOM1: SGN-S1-1-4.3.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174111 [TUS-17-O5] Trace: SGN-T1302 EST: SGN-E378665 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174111 [TUS-17-O5] Trace: SGN-T191458 EST: SGN-E390132 Direction: 5' Facility: INRA
Clone: SGN-C174111 [TUS-17-O5] Trace: SGN-T191661 EST: SGN-E390335 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208368Length: 414 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208368 [] (trimmed) GCAAAACCTAAAATCCCCCCCCCCCCCAAAAAAAAAAACAATTCTTGAACCATTTGGTTTTTGTAGAATCAAGAAAAGGGGGAAAATAAAAATCC
AATCTTGATAATCAAAAAAAAAAAATGGATAGTAAGCTCTTAACAAGTAATTTGGTGTTGTTTTCATCAATCTTGTTAACTCTATTTACTTTTTC
ATATGGTCAAAATTGTTCAACTCATCAATTCACAAACAACAATATTTTTTCCACTTGTAACCCTCTCCCTGTTCTCAACTCTTTTCTTCACTGGA
CTTATTACCCTGATAATCACACAGTAGATCTTGCTTATAGACATGGCGGTGTTACTGAATCTTCTTGGGTAGCTTGGGCTTTGAATCCTGTTGGT
ACAGGAATGGCTGGATGTCAAAGTTTAATTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208368] SGN-U581879 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31359 [Download] [View] Facility Assigned ID: TCAFP52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5