EST details — SGN-C70586

Search information 
Request: 70586Match: SGN-C70586
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70586Clone name: cLER-15-E8
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183607 is on microarray TOM1: SGN-S1-1-4.2.1.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183607 [TUS-42-J21] Trace: SGN-T196096 EST: SGN-E394770 Direction: 5' Facility: INRA
Clone: SGN-C183607 [TUS-42-J21] Trace: SGN-T200373 EST: SGN-E399400 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282810Length: 300 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282810 [] (trimmed) GGAAATTCCATTGCTAAGTCTGGAGGATATTTTCACCAACATGGGAATGGACCTAGATCATGTGCAGTCTCTATTAGGAGATATTCAGCCGAGAT
TTCCTCTTCTGAGCAGATGAACTTAATAAAACAGCTGAGAGAAAGAACAAGTGCTCCCATAAAAGAAGTCAAAGCTGCTCTTGTCACTAGCAATT
GGGATATCGAGGCTGCTCAGAAAGACCTAAGAAAAAGAGGAATAGTTCTTGCATCAAAGAAATCTTCTCGAACTGCTGCTGAAGGGTTGCTTGCC
TTGGCACAGAATGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282810] SGN-U584457 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95330 [Download] [View] Facility Assigned ID: TPRCF28THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5