EST details — SGN-C70627

Search information 
Request: 70627Match: SGN-C70627
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70627Clone name: cLER-15-G4
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178764 is on microarray TOM1: SGN-S1-1-7.1.3.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178764 [TUS-30-A2] Trace: SGN-T1512 EST: SGN-E378695 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178764 [TUS-30-A2] Trace: SGN-T184481 EST: SGN-E371867 Direction: 5' Facility: INRA
Clone: SGN-C178764 [TUS-30-A2] Trace: SGN-T184557 EST: SGN-E371943 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282814Length: 339 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282814 [] (trimmed) CCAGCAAAGGTAACAAAAGTTTATTGCTTTAAAAAGGACCTCAGTTGGACTGTAAGTGATTAATATACAAACTGCATACATGGGAACCAACATGT
GCTGGATTTCTTTACAATATATAAGCATGAGAACATGTACTTGAAAGCAATTCATGGTTGGATTTTCTTCCCCTTTCACCTTTCTGAAGCTTGAT
ATTAGGGGCCTCTTAGTTTTTGTACTTCATGGTTTCCTTCTCAAACCCAATTGTAGGGAACTGCTTAGCATACTCCTCCACATCCTGACGGAGTT
TTGCAATTTCAGACTTGATTGGAGCACTGGATTCTAGTGTTGATACAAAGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282814] SGN-U577517 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95334 [Download] [View] Facility Assigned ID: TPRCF38THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0315 Quality Trim Threshold: 14.5