EST details — SGN-C70740

Search information 
Request: 70740Match: SGN-C70740
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70740Clone name: cLER-15-L8
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185379 is on microarray TOM1: SGN-S1-1-8.4.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185379 [TUS-47-D17] Trace: SGN-T192312 EST: SGN-E390986 Direction: 3' Facility: INRA
Clone: SGN-C185379 [TUS-47-D17] Trace: SGN-T192313 EST: SGN-E390987 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282742Length: 519 bp (823 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282742 [] (trimmed) GAAAAAACGAACACCAATGGCTTCCAGCATCACTGCTTGTACCACCACCTCTTTAGCCGCCCGTGAGGCCCTCCTACATAAGGCATCAGCTCTAT
CCCGCCCTTCTGTTCTTGGGTTGCCATCAATGAGGAAGAATGTGGGAAGGGTGAAGTGTTCAATGGAAAGAGAGGATTCAAAATCAGGAATTTGT
GGATCATTAGTGGCAGCAACACTATCATTCAGCCCAACAGCAATGGCTTTAGTGGATGAAAGAATGAGTACAGAAGGAACTGGGCTTCCATTTGG
GCTCAGTAATAATCTTCTTGGTTGGATCCTTTTTGGAGTCTTTGGTTTGGTTTGGTCTCTTTATACTGTTTACACTTCTAGCCTTGATGAGGATG
AAGATTCTGCAATGTCCCTTTAATTTCAACTTCAGATTACTATGTAAAATCATGAATTCTATTCTATCATTTCCTCTCTTTACCTTCTTCCATGG
CTAATTGTACTATATACATACGAATTACTATTACTAATTATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282742] SGN-U581562 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95262 [Download] [View] Facility Assigned ID: TPRCH64THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0048 Quality Trim Threshold: 12.5