EST details — SGN-C70830

Search information 
Request: 70830Match: SGN-C70830
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70830Clone name: cLER-16-A20
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C182541 is on microarray TOM1: SGN-S1-1-6.2.8.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182541 [TUS-39-N11] Trace: SGN-T1729 EST: SGN-E378215 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284205Length: 495 bp (745 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284205 [] (trimmed) TTTTAGCAAAGCTCAGAAAAGTTTTAAGACATCATGGGTAAAGAGAAGATTCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGAAAGTC
GACCACTACTGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTGATCGAGAGGTTTGAGAAAGAAGCAGCTGAGATGAACAAGAGGT
CATTCAAGTATGCATGGGTGCTTGACAAGCTTAAGGCTGAGCGTGAACGTGGTATTACCATTGATATTGCCTTGTGGAAGTTTGAGACCACAAAG
TACTACTGCACTGTGATTGATGCTCCTGGACACAGAGATTTCATCAAGAACATGATTACTGTTGCTGTTGGAGTTGTCAAGAACGTCGACAAGAA
AGACCCTACTGGTGCTAAAGTCACCAAGGCTGCCCAAAAGAAGAAGTGATGTGTTTTTGATGAGATTCTGCATTGATGAACTAGTTTTGTTTAAT
TGCATTAACTATTTTCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284205] SGN-U578422 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95478 [Download] [View] Facility Assigned ID: TPRCJ10THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5