EST details — SGN-C71403

Search information 
Request: 71403Match: SGN-C71403
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71403Clone name: cLER-17-M11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185398 is on microarray TOM1: SGN-S1-1-5.1.9.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185398 [TUS-47-E12] Trace: SGN-T191937 EST: SGN-E390611 Direction: 5' Facility: INRA
Clone: SGN-C185398 [TUS-47-E12] Trace: SGN-T192179 EST: SGN-E390853 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282947Length: 449 bp (635 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282947 [] (trimmed) AAAATTCATCACCCCCCATGGCTTCGTTATCCCTAATCTCACCTCACTCTCCTTCTTCTTCTTCTTCTTCTACTCTCCGTCACAGTTCCATTATT
GGCACCCGTCTTCCTTCCATCTTCTTGCGCAACCCCACTATCCGCATTCGCTCCACAACCCCTTCAATTAAAGCCTTCTCTGCACCCGTTCCTTC
ACCTTTAACCCAAGATGAACTTAAGAAACTAGCAGCCGATAAGGCCGTTGAGTATGTCAAAAGTGGAATGGTCCTTGGTTTAGGCACTGGGTCAA
CAGCAGCTTTCGTTGTCGCTAAATTGGGTGAGCTTCTTTCATCGGGCCAACTCACGAACATTGTAGGAGTTCCCACTTCAAAGCGTACTGAAGAA
CAAGCTTTGTCGCTTAACATCCCGTTATCTACACTTGACGACCACCCACATATTGATCTTGCTATTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282947] SGN-U570787 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95798 [Download] [View] Facility Assigned ID: TPRCM78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5