EST details — SGN-C71992

Search information 
Request: 71992Match: SGN-C71992
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71992Clone name: cLER-19-M9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185409 is on microarray TOM1: SGN-S1-1-2.1.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185409 [TUS-47-E23] Trace: SGN-T197623 EST: SGN-E396297 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284988Length: 524 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284988 [] (trimmed) CGCATCGAAGAATATTTTATTTTAACTTACTAACAAAAAGGCTGGAAGACAAATTTTATCTATAATATTTCAAAAATAAAAATAAAAATACACCA
CATGAAGAATTACAAGTCTAGTGCACCATAATTGCATACAAATTCAAAGATCACAACTAGTTTTTACAAACAAAACTAGCATTACAATACATCTT
TATTCAAAATTACATAATATTTTTTTTCTTCTCAAACTTCTTCTTTTACACATAAAAATCAAAATTATTTATTTAGCATGGCTTGGTGCAAAAGC
AACGGCGACGGAATCCACGGCAATTACCACCGGAAAATCTTTCGGTCTCGCAAACCGAGGCACAATTCTTATCGCTCACACATGGTCCCTTGAAA
CGATGGCTCAACGACTCACAATGTCTTGCCTCTACGATTCTCGTTGGTCCCATTTCAGTAGCCATAACAAGCATGGCTAGAAGAAACAAAGTAGC
AAAGAAACGAATGGATTGTGCCATTTTCACAAATTTTTTTGAGCCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284988] SGN-U581633 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96560 [Download] [View] Facility Assigned ID: TPRCU77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5