EST details — SGN-C72099

Search information 
Request: 72099Match: SGN-C72099
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72099Clone name: cLER-1-C23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184987 is on microarray TOM1: SGN-S1-1-8.4.12.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72099 [cLER-1-C23] Trace: SGN-T91829 EST: SGN-E280275 Direction: 3' Facility: TIGR
Clone: SGN-C184987 [TUS-46-D9] Trace: SGN-T199020 EST: SGN-E397694 Direction: 3' Facility: INRA
Clone: SGN-C184987 [TUS-46-D9] Trace: SGN-T199021 EST: SGN-E397695 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280274Length: 490 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280274 [] (trimmed) CTTGTGCCCCCCTTAATAGTGAAAATTTTCAATTGTTAATTTTCTCGTTAAAAATGCCGATCAACCAAATTACTATTGGAAGCCATGAGGAACTC
CGCCATCCCGGGGCGCTTAAAGCGGCCTTGGCGGAGTTCATCAGTACCCTGATCTTCGTATTCGCAGGTCAGGGTTCTGGTATGGCTTTCAATAA
GCTTACCGATGGCGTCGCTACTCCCGCTGGCCTTATTTCCGCCTCCATAGCACACGCCTTCGGGTTGTTCGTCGCCGTCTCCGTCGGTGCTAACA
TCTCCGGCGGCCACGTCAACCCTGCTGTTACCTTCGGTGCTTTTGTTGGTGGAAACATCACTTTGTTCCGTGGAATTTTGTACATCATTGCACAG
TTGCTTGGATCCACTGCTGCTTGCGCTCTCCTTGAATTCGCCACCGGTGGCATGAGCACGGGATCATTTGCATTGTCAGCCGGTGTATCAGTATG
GAACGCGTTCGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280274] SGN-U581024 Tomato 200607 Build 2 145 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91828 [Download] [View] Facility Assigned ID: TPRAA24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5