EST details — SGN-C72194

Search information 
Request: 72194Match: SGN-C72194
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72194Clone name: cLER-1-H11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178551 is on microarray TOM1: SGN-S1-1-4.4.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178551 [TUS-29-H5] Trace: SGN-T184125 EST: SGN-E371056 Direction: 3' Facility: INRA
Clone: SGN-C178551 [TUS-29-H5] Trace: SGN-T184126 EST: SGN-E371057 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280394Length: 460 bp (721 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280394 [] (trimmed) TTCAGCTGACCCTGAAACATTCGCTAAGAACCGTGAGTTGGAGGTTATTCATTGCAGATGGGCCATGCTTGGTGCTCTTGGATGTGTTTTCCCCG
AGCTTTTGGCACGTAACGGTGTTAAGTTTGGTGAAGCTGTATGGTTCAAAGCTGGATCTCAAATTTTCAGCGAGGGCGGACTTGACTACTTGGGA
AACCCTAGTTTGGTTCATGCACAAAGCATTTTGGCTATTTGGGCTTGCCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACCGTATTGCTGGTGG
GCCTCTTGGTGAGGTTGTTGATCCACTTTACCCTGGTGGTAGCTTTGACCCATTGGGCCTTGCTGAAGACCCAGAGGCTTTTGCTGAGCTCAAGG
TGAAGGAGATCAAGAATGGTAGACTTGCTATGTTCTCCATGTTTGGATTCTTTGTTCAAGCTATTGTCACCGGAAAGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280394] SGN-U581203 Tomato 200607 Build 2 306 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91948 [Download] [View] Facility Assigned ID: TPRAC42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5