EST details — SGN-C72246

Search information 
Request: 72246Match: SGN-C72246
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72246Clone name: cLER-1-J3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185045 is on microarray TOM1: SGN-S1-1-6.2.11.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185045 [TUS-46-F19] Trace: SGN-T199031 EST: SGN-E397705 Direction: 3' Facility: INRA
Clone: SGN-C185045 [TUS-46-F19] Trace: SGN-T199032 EST: SGN-E397706 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280605Length: 464 bp (726 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280605 [] (trimmed) AAAATTCTCCATAAAATTCTAAGCAAAACCCATAAATTTTCTTTGATTTTTGAGTATTAATAACCATGGAAGCTGTGTTCAAAACCCAGAGTTTG
TTCTTGAAGTTATGGGGTTTGTTGGCAGTTGTTCTTGCTGTAGCTGTGGCTGTAAAGGGGAATTCAGAAGGGGATGCTTTGTACGCCCTCCGCCG
GAGCTTATCTGACCCGGGTAACGTGTTACAGAGCTGGGATCCAAATCTTGTTAACCCTTGTACCTGGTTTCATGTCACTTGCAACGGAGATAATC
AAGTTACTCGTGTGGATCTTGGGAACTCAAAGTTATCTGGTCATTTGGTACCTGAGCTCGGAAAGCTTGAACATCTACAGTATCTGGAGCTTTAC
AAAAATAATATTCAGGGAACCATCCCTAAGGAGCTCGGTAACTTGAAGAGCCTTATTAGTCTGGATCTGTACAACAACAATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280605] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92159 [Download] [View] Facility Assigned ID: TPRAC50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5