EST details — SGN-C72262

Search information 
Request: 72262Match: SGN-C72262
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72262Clone name: cLER-1-K19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185047 is on microarray TOM1: SGN-S1-1-4.2.11.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185047 [TUS-46-F21] Trace: SGN-T1862 EST: SGN-E378640 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185047 [TUS-46-F21] Trace: SGN-T199033 EST: SGN-E397707 Direction: 3' Facility: INRA
Clone: SGN-C185047 [TUS-46-F21] Trace: SGN-T200099 EST: SGN-E398773 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280513Length: 406 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280513 [] (trimmed) CCACTCTTTCAAAACAAAAGCACTTCCAGATTCTCCAAAGAAACACTGCACTAGCAATGATTAAATAATTCAGTACATCCACGAAGTCAAAATCC
TTTTTAACTGTGCCATTAAAAAACCATCTATTGTAGAACTCGAAATATCTAATCTTTATCCAAAAAAAGGATGAAGAGCTTGAAGGAAAAAGGCT
CATTCCCAGCCTGTAGCACCAGAGGTAGGGGCAACATCTGGTACTGGTAGAGGAACTGGTGCAGGGGCTGCTGCTGCATCCCATCCGCCATCAGC
TGCTCCATCTCCAGCCCAACCACCACCTACTGCAGGTGCTGCAGCATCTGCAGTCCATTGCGCCTCAGGGATTTGGCTACTAGTCCAGTCACCAC
CAAGGGCAGCACTCGCAGAGTAGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280513] SGN-U579857 Tomato 200607 Build 2 163 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92067 [Download] [View] Facility Assigned ID: TPRAA70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5