EST details — SGN-C72294

Search information 
Request: 72294Match: SGN-C72294
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72294Clone name: cLER-1-M1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178628 is on microarray TOM1: SGN-S1-1-7.3.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178628 [TUS-29-K10] Trace: SGN-T183932 EST: SGN-E371603 Direction: 3' Facility: INRA
Clone: SGN-C178628 [TUS-29-K10] Trace: SGN-T183933 EST: SGN-E371604 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280319Length: 291 bp (830 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280319 [] (trimmed) AACAGAAAACAAAAGGCATCTTTCAGTTAAATGACAATTTCCAGTAACACGAGTTTCTCCAACAACGATTCAGGAGACATTTTATGCAATACAAA
AATGTTGTATTTGATAGTCATAAAAAAAAAAAAGGGGCCCAAAAGAAAAAAGAGCTGTCAAGTAAGGGAGCCTCCACACAGGAGCAACCTTAAGG
GGGGCCAGATTCATTTCTTATGCTTTGGCACAAATGGAGAGGTCTTTGCATCCTCCTCAGTAAAACCGAGGGACATCTTGGTGATGATAGGGCCG
GTGACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280319] SGN-U578735 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91873 [Download] [View] Facility Assigned ID: TPRAA73TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0377 Quality Trim Threshold: 12.5