EST details — SGN-C72311

Search information 
Request: 72311Match: SGN-C72311
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72311Clone name: cLER-1-M5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178640 is on microarray TOM1: SGN-S1-1-3.3.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72311 [cLER-1-M5] Trace: SGN-T91876 EST: SGN-E280322 Direction: 3' Facility: TIGR
Clone: SGN-C178640 [TUS-29-K22] Trace: SGN-T184007 EST: SGN-E371678 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280321Length: 359 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280321 [] (trimmed) ATATAAATAGATTTTTTTGATCTGACACGAATTCTCAAAGGTATTTGTACACTGAGTCTTTTTCTACAGGAGGGCAAACCAAATGTAGGTATACT
ACATTGAGTGGCAAAAGAAACATTAAAGTTTTTCTTTGCACAAATCTACTTCAAATGTTACTTTTACACATCATTACAACAAAAGGTGTTCTGCT
TCTGCTTCTCACTTGGGACTGAATGCAGCAAAAATAGTGGCATGACCAGGATCAGCTAGGTGAGCAAATAGGTTATCAATAGGGCCTGTTCCAGT
GTAAATGTGTTGGAACCATGCACCCATAACGGCTAACATAGCAAGTCTACCGTTCTTAATCTCCTTTGTCCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280321] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91875 [Download] [View] Facility Assigned ID: TPRAA75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0184 Quality Trim Threshold: 14.5