Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C72345

Search information 
Request: 72345Match: SGN-C72345
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72345Clone name: cLER-1-O17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178668 is on microarray TOM1: SGN-S1-1-7.1.4.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72345 [cLER-1-O17] Trace: SGN-T92083 EST: SGN-E280529 Direction: 3' Facility: TIGR
Clone: SGN-C178668 [TUS-29-M2] Trace: SGN-T184008 EST: SGN-E371679 Direction: 3' Facility: INRA
Clone: SGN-C178668 [TUS-29-M2] Trace: SGN-T184009 EST: SGN-E371680 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280528Length: 452 bp (862 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280528 [] (trimmed) CAAAATTCATCTGTTTTCTCTACAAATTAGCAAATCTAAGCGAAACCCAGAAGGGATTTTAAGCTCAGAAAATGGAATCAGCTGCTAGAAGAAGT
GGTGGTGGTGTTCTTGAAGGATTTTACAGGCTGGTTATGCGCCGTACCCCTGTCTATGTTACCTTTGTCATCGCCGGCGCTTTGCTCGGCGAACG
GGCAGTGGATTATGGCGTTAAAACTCTCTGGGAGAAGAACAATGTTGGGAAGCGTTACGAGGATATTTCAGTTCTTGGACAGCGGCCTGTTGATG
AATAAATTTTCAGTAATGAAGTTTATTTGAGACGAGACAAAGTACTTGTTATCGATATTTCAATAATTGTTTTGCTAATCGCCATTGCTGGCTTT
CTTTTATATTTTTGCTGTAGTTTTGAAGGAAATTCATTGAATGAAATATGATACCAAATTGAAATTTTTGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280528] SGN-U570518 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92082 [Download] [View] Facility Assigned ID: TPRAA93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5