EST details — SGN-C7258

Search information 
Request: 7258Match: SGN-C7258
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C7258Clone name: cLEC-38-G12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183878 is on microarray TOM1: SGN-S1-1-5.2.19.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183878 [TUS-43-F4] Trace: SGN-T198098 EST: SGN-E396772 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209133Length: 589 bp (749 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209133 [] (trimmed) CAGTGGTGGAGTCTTACAGTGTACCGGATGGGGCAAACCCCCAAACACCCTAGCCGAGTACGCCTTGGACCAGTTTAGCAACTTAGATTTTTGGG
ACATTTCTTTAGTCGATGGATTTAATATTCCATGACTTTTGCCCCAACAAAACCTAGTGGAGGAAAATGTCACGCAATTCATTGCACGGCCAATA
TAAATGGTGAATGTCCTCGCGCCCTTAAGGTACCTGGAGGATGTAACAACCCTTGTACCACGTTTGGAGGACAACAATATTGTTGCACCCAAGGT
CCATGTGGCCCTACAGAGTTGTCCAAATTTTTCAAGAAAAGATGTCCCGATGCTTATAGCTACCCACAAGACGATCCTACAAGCACATTTACTTG
CCCTGGTGGTAGTACAAACTATAGGGTTGTCTTTTGTCCTAATGGTGTTGCTGATCCAAATTTCCCCTTGGAGATGCCTGCAAGTACTGATGAAG
TGGCCAAGTGAATTTGAGTTTCTTCATTTTAAATCGCCTCAATTAGTCAACTGATCTCTACCGTAATGAAAAATCTTAATAGCTCAGTTTTTTTA
AATATTCACTTTTACTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209133] SGN-U579414 Tomato 200607 Build 2 213 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31668 [Download] [View] Facility Assigned ID: TCAFT42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5