EST details — SGN-C72641

Search information 
Request: 72641Match: SGN-C72641
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72641Clone name: cLER-20-M2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184218 is on microarray TOM1: SGN-S1-1-1.4.16.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184218 [TUS-44-D8] Trace: SGN-T198365 EST: SGN-E397039 Direction: 3' Facility: INRA
Clone: SGN-C184218 [TUS-44-D8] Trace: SGN-T198366 EST: SGN-E397040 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285164Length: 472 bp (812 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285164 [] (trimmed) CCGCGATGTCAAGGCTCAGAACATTTTGTTAGGTGATCGTTACGAGCCGTGTTTAGCTGATTTTGGACTTGCTAGACTCATGGAGGAGGAAAATT
CTTCAATTACAGCAAATCCTCAGTTTGCTGGATCTTATGGCTACTTTGCCCCAGAGTACGCTTGTATGCTAAAGATTACAGAGAAGAGCGATGTT
TTTAGCTTTGGAGTTGTGTTGCTAGAAATCATTACTGGGAAAAAGCCAGCCGACCCATCCTTCCCTGATGGACAACATGTTATACAATGGGTTCG
CGACCACCTAAAGAGCAAGAAAGATCCAGTTGACGTAATTGATCCAAGGATACAAGGGCATCCTGATACACAAATTCAAGAAATGCTTCAAGCCC
TTGGAATAGCCCTGTTGTGTACTAGTAATCGGGCTGAAGATCGCCCAACAATGAAAGATGTGGTGGCATTACTCAAGGAGATTATCCATGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285164] SGN-U568560 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96736 [Download] [View] Facility Assigned ID: TPRCZ73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5