EST details — SGN-C73170

Search information 
Request: 73170Match: SGN-C73170
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73170Clone name: cLER-3-J11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185307 is on microarray TOM1: SGN-S1-1-8.1.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185307 [TUS-47-A17] Trace: SGN-T192048 EST: SGN-E390722 Direction: 5' Facility: INRA
Clone: SGN-C185307 [TUS-47-A17] Trace: SGN-T192293 EST: SGN-E390967 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277513Length: 420 bp (762 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277513 [] (trimmed) AAAATAAAAAATAAAAAAATATGCTAAGCATCAGAGTAACAGCAACCATTTCTTCTTCTTCAACTCTTTTCTTTACAAATTCCAAAAAAATTTCG
AATAAATTCTCTTACATTTCAAATCCATTGAAAAATTCTTCAAAACCCATTAAATGGAACTGTAAAAATTCAAGAATGGAGTCATCAAAATCAAG
TTTTGTTACCAAAGCTTCAGCACAGCCACTTACAAATCCTGCAGAACTCATTGATTCTGTTGAAACTTTCATCTTCGATTGTGATGGAGTTATAT
GGAAAGGAGATAAACTGATAGACGGAGTCCCTGAAACTTTGGATTTGCTCAGGGAAAAGGGAAAAAGATTAGTTTTTGTTACCAACAACTCAACA
AAGTCTAGAAAGCAGTATGGGAAAAAATTTGAAACACTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277513] SGN-U569247 Tomato 200607 Build 2 64 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92401 [Download] [View] Facility Assigned ID: TPRAK54THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5