Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C73206

Search information 
Request: 73206Match: SGN-C73206
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73206Clone name: cLER-3-M1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185311 is on microarray TOM1: SGN-S1-1-4.1.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185311 [TUS-47-A21] Trace: SGN-T192049 EST: SGN-E390723 Direction: 3' Facility: INRA
Clone: SGN-C185311 [TUS-47-A21] Trace: SGN-T192050 EST: SGN-E390724 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277353Length: 556 bp (643 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277353 [] (trimmed) CCGCATATCGCCTAATTTTTCTTCTCTAAGTTTCTTAGTGTCTCAAGATGGGTAAAGAGAAGATTCACATCAGCATCGTGGTCATTGGTCATGTT
GACTCTGGAAAGTCGACTACCACTGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCGAGAAGGAAGCTGCTGA
GATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCAGAACGTGAGCGTGGTATCACCATTGATATTGCTTTGTGGAAGT
TTGAGACCACTAAGTACTACTGCACTGTTATTGATGCCCCCGGCCACAGGGATTTCATCAAGAACATGATCACTGGTACCTCTCAGGCTGACTGT
GCTGTTCTCATTATTGACTCCACTACTGGTGGTTTTGAAGCTGGTATCTCCAAAGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCT
TGGTGTCAAGCAAATGATCTGCTGCTGTAACAAGATGGATGCTACCACCCCCAAGTACTCCAAGGCTAGGTATGATGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277353] SGN-U580418 Tomato 200607 Build 2 320 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92241 [Download] [View] Facility Assigned ID: TPRAI73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0013 Quality Trim Threshold: 20.5