EST details — SGN-C73284

Search information 
Request: 73284Match: SGN-C73284
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73284Clone name: cLER-4-C1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185935 is on microarray TOM1: SGN-S1-1-4.3.7.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278039Length: 417 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278039 [] (trimmed) TGGCTTTCTCTGACATTTCTTCAGCAGCTGTTGCCACACGCAGCAATGTTACACACGCTAGCATGGTTGCACCTTTCACTGGTCTAAAATCTTCA
GCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTTCATTGCTAGCAATGGTGGAAGAGTTAGCTGCATGCATGTGTGGCCACCAAT
TAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTTGTCTGACGAGCAATTGCTCTAGTGAAATTGAGTACCTTTTGAAAAATGGATGG
GTTCCTATGCTTGGAATTTGAGACTGAGCACGGATTTGTCTACCGCGAGAACAACAAGTCACCACGATACTATGATCGAAGGTACTGGACCATGT
GGAAGTTGCCTATGTTTGGGTGCACTGATGCAACCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278039] SGN-U578689 Tomato 200607 Build 2 989 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92872 [Download] [View] Facility Assigned ID: TPRAM13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0316 Quality Trim Threshold: 14.5