EST details — SGN-C73362

Search information 
Request: 73362Match: SGN-C73362
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73362Clone name: cLER-4-H1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185317 is on microarray TOM1: SGN-S1-1-6.2.10.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185317 [TUS-47-B3] Trace: SGN-T192217 EST: SGN-E390891 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278004Length: 408 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278004 [] (trimmed) ATCTTATAAACCTCATTCCTCTCAAACAACATCCCATGGCTCCTGCTCTTGAACAAGCAATAACCAGCGATGCATCATCGGACGTTACCATCACT
GGAAAGATATACACACGAGTTCGTCTCGCTACGAAATCTGATCTTTCTCATATATACCGATTGTTTTACCAAATCCATGAATACCATAACTATAC
TCATTTATACAAAGCTACTGAGTCCTCCTTAGCCAACTTGCTCTTTAAGGAAAACCCTCTTCCACTTTTCTACCGGCCATCTGTTCTTCTACTTG
AAGTCTCTCCAACCCCTTTTGACGAACCTAAAAATACTACAGACGAAGGGTTCAAGCCTGTCCTTACAACGTTTGACCTTAAATTCCCAGTCGTA
GAAGGAGAAGTTGAGGAATTCCGATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278004] SGN-U578909 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92837 [Download] [View] Facility Assigned ID: TPRAO37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5