EST details — SGN-C74066

Search information 
Request: 74066Match: SGN-C74066
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C74066Clone name: cLER-7-J9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185334 is on microarray TOM1: SGN-S1-1-5.2.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185334 [TUS-47-B20] Trace: SGN-T192459 EST: SGN-E391133 Direction: 5' Facility: INRA
Clone: SGN-C185334 [TUS-47-B20] Trace: SGN-T192651 EST: SGN-E391325 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281144Length: 321 bp (758 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281144 [] (trimmed) AAATCTAGCAAGTCATATATATATATATATATATATATAAACACATAGATGAAAGTTAAAAAGAGGGGAGAAGAGATCAAGTTGTGTACAATAAT
TTGTTTGTGAAAAAAGTTGCAGTAGTTGCAAGGTAAAAACATATACAATAAATGCTCCAACCATCTTTTTTCTATTACATCCTGGAATAACCTTT
GGGGGCTTCATATTTCTCCATGAATTCATCATTGAACTTTTTGAAACTTTCCATTATTGGTGGCATGTCTTCTTCAGCTGGCAAGATGGTTGTCC
TTAGATGGAACACCCCTTTCTTTTGACCGAAACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281144] SGN-U580454 Tomato 200607 Build 2 64 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93607 [Download] [View] Facility Assigned ID: TPRBA53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0190 Quality Trim Threshold: 14.5