EST details — SGN-C75192

Search information 
Request: 75192Match: SGN-C75192
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75192Clone name: cLES-13-D14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185523 is on microarray TOM1: SGN-S1-1-8.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185523 [TUS-47-J17] Trace: SGN-T192350 EST: SGN-E391024 Direction: 5' Facility: INRA
Clone: SGN-C185523 [TUS-47-J17] Trace: SGN-T192623 EST: SGN-E391297 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286144Length: 453 bp (775 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286144 [] (trimmed) AAGGTCAATTGTATAGAGAGTACCTTTTTTTGTGTAAAATTTAAAGTGCAATAATTTTGAAGAATTCATCAATGGCAAGTTTAAGCAGATTCTTG
AAGAAAAGATCATTAGATTATAATAATGTTGATTTGATGAGAGCAGCTAGCAACAGATTGTTCTCTACACAACTTCCTCATACTAACATCAAGTC
TGAAGTTTCTCAATTAATTGGGAAAACACCAATGGTTTATCTTAAAAAAGTGACAGAAGGATGTGGAGCCTATATAGCTGTGAAACAGGAGATGT
TTCAGCCTACTTCTAGCATCAAAGACAGACCAGCATTGGCAATGATCAATGATGCAGAAAAAAAAGGCTTAATATCACCTGAAAAGACGACGTTG
ATTGAGCCAACATCAGGAAATATGGGGATCAGTATGGGATTTATGGCACCAATGAAAGGCTACAAAATGGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286144] SGN-U570112 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100457 [Download] [View] Facility Assigned ID: TPSBZ19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5