EST details — SGN-C75506

Search information 
Request: 75506Match: SGN-C75506
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75506Clone name: cLES-14-F24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186042 is on microarray TOM1: SGN-S1-1-1.4.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186042 [TUS-48-P8] Trace: SGN-T192771 EST: SGN-E391445 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286878Length: 602 bp (820 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E286878 [] (trimmed) CTTGACTGGTGAATTCCCTGGTGACTACGGCTGGGATACCGCTGGACTCTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGA
TCCACTGCAGATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTC
AAGGCCGGATCCCAGATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTGGCCATCTGGGCTTG
CCAAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCTTCG
ACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTATGTTCGGA
TTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAACGCTTGGGCTTTCGC
CACAAACTTTGTCCCCGGAAAATGAATATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286878] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100699 [Download] [View] Facility Assigned ID: TPSCD36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0063 Quality Trim Threshold: 12.5